Mature sequence ptr-miR-377

Accession numberMIMAT0008129
IDptr-miR-377
Stem-Loop ptr-mir-377
Sequence
aucacacaaaggcaacuuuugu
Get sequence
Deep sequencing reads, experiments
Predicted targets

References

1
PMID:18760970 "Computational identification of novel microRNA homologs in the chimpanzee genome" Baev V, Daskalova E, Minkov I Comput Biol Chem. 33:62-70(2009).