Mature sequence mmu-miR-1906

Accession numberMIMAT0007872
IDmmu-miR-1906
Stem-Loop mmu-mir-1906-1 mmu-mir-1906-2
Sequence
ugcagcagccugaggcagggcu
Get sequence
Deep sequencing20 reads, 9 experiments
Predicted targets

References

1
PMID:18492288 "MicroRNA-encoding long non-coding RNAs" He S, Su H, Liu C, Skogerbo G, He H, He D, Zhu X, Liu T, Zhao Y, Chen R BMC Genomics. 9:236(2008).