Mature sequence osa-miR1861n

Accession numberMIMAT0007809
IDosa-miR1861n
Stem-Loop osa-MIR1861n
Sequence
cgaucuuguggcaggagcugag
Get sequence
Deep sequencing1 reads, 1 experiments

References

1
PMID:18687877 "A diverse set of microRNAs and microRNA-like small RNAs in developing rice grains" Zhu QH, Spriggs A, Matthew L, Fan L, Kennedy G, Gubler F, Helliwell C Genome Res. 18:1456-1465(2008).