Mature sequence osa-miR1861l

Accession numberMIMAT0007807
IDosa-miR1861l
Stem-Loop osa-MIR1861l
Sequence
cgaucuugaggcaggaacugag
Get sequence
Deep sequencing186 reads, 2 experiments
Database links
QuickGO function

References

1
PMID:18687877 "A diverse set of microRNAs and microRNA-like small RNAs in developing rice grains" Zhu QH, Spriggs A, Matthew L, Fan L, Kennedy G, Gubler F, Helliwell C Genome Res. 18:1456-1465(2008).
2
PMID:22158467 "Massive analysis of rice small RNAs: mechanistic implications of regulated microRNAs and variants for differential target RNA cleavage" Jeong DH, Park S, Zhai J, Gurazada SG, De Paoli E, Meyers BC, Green PJ Plant Cell. 23:4185-4207(2011).