Mature sequence osa-miR1428e-3p

Accession numberMIMAT0007785
IDosa-miR1428e-3p
Stem-Loop osa-MIR1428e
Sequence
uaagauaaugccaugaauuug
Get sequence
Deep sequencing4 reads, 2 experiments
Database links
QuickGO function

References

1
PMID:18687877 "A diverse set of microRNAs and microRNA-like small RNAs in developing rice grains" Zhu QH, Spriggs A, Matthew L, Fan L, Kennedy G, Gubler F, Helliwell C Genome Res. 18:1456-1465(2008).
2
PMID:19055717 "Identification of precursor transcripts for 6 novel miRNAs expands the diversity on the genomic organisation and expression of miRNA genes in rice" Lacombe S, Nagasaki H, Santi C, Duval D, Piegu B, Bangratz M, Breitler JC, Guiderdoni E, Brugidou C, Hirsch J, Cao X, Brice C, Panaud O, Karlowski WM, Sato Y, Echeverria M BMC Plant Biol. 8:123(2008).
3
PMID:19103661 "Characterization and expression profiles of miRNAs in rice seeds" Xue LJ, Zhang JJ, Xue HW Nucleic Acids Res. 37:916-930(2009).