Mature sequence osa-miR1849

Accession numberMIMAT0007769
IDosa-miR1849
Stem-Loop osa-MIR1849
Sequence
uaucguauccuagguugguuu
Get sequence
Deep sequencing34 reads, 2 experiments
Database links
QuickGO function

References

1
PMID:18687877 "A diverse set of microRNAs and microRNA-like small RNAs in developing rice grains" Zhu QH, Spriggs A, Matthew L, Fan L, Kennedy G, Gubler F, Helliwell C Genome Res. 18:1456-1465(2008).
2
PMID:19903869 "Rice MicroRNA effector complexes and targets" Wu L, Zhang Q, Zhou H, Ni F, Wu X, Qi Y Plant Cell. 21:3421-3435(2009).