Mature sequence gga-miR-10a-5p

Accession numberMIMAT0007731
IDgga-miR-10a-5p
Previous IDsgga-miR-10a
Stem-Loop gga-mir-10a
Sequence
uacccuguagauccgaauuugu
Get sequence
Deep sequencing2459657 reads, 5 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:18469162 "A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach" Glazov EA, Cottee PA, Barris WC, Moore RJ, Dalrymple BP, Tizard ML Genome Res. 18:957-964(2008).
2
PMID:18511220 "Identification of novel chicken microRNAs and analysis of their genomic organization" Shao P, Zhou H, Xiao ZD, He JH, Huang MB, Chen YQ, Qu LH Gene. 418:34-40(2008).