Mature sequence gga-miR-1721

Accession numberMIMAT0007619
IDgga-miR-1721
Stem-Loop gga-mir-1721
Sequence
agagaugauguuggucugaug
Get sequence
Deep sequencing3 reads, 1 experiments
Predicted targets

References

1
PMID:18469162 "A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach" Glazov EA, Cottee PA, Barris WC, Moore RJ, Dalrymple BP, Tizard ML Genome Res. 18:957-964(2008).