Mature sequence gga-miR-1605

Accession numberMIMAT0007471
IDgga-miR-1605
Stem-Loop gga-mir-1605
Sequence
aggguuucauguguaucucuug
Get sequence
Deep sequencing reads, experiments
Predicted targets

References

1
PMID:18469162 "A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach" Glazov EA, Cottee PA, Barris WC, Moore RJ, Dalrymple BP, Tizard ML Genome Res. 18:957-964(2008).