Mature sequence hsa-miR-103b

Accession numberMIMAT0007402
IDhsa-miR-103b
Previous IDshsa-miR-103-as
Stem-Loop hsa-mir-103b-1 hsa-mir-103b-2
Sequence
ucauagcccuguacaaugcugcu
Get sequence
Deep sequencing3 reads, 2 experiments
Predicted targets

References

1
PMID:18524951 "Characterization of endogenous human Argonautes and their miRNA partners in RNA silencing" Azuma-Mukai A, Oguri H, Mituyama T, Qian ZR, Asai K, Siomi H, Siomi MC Proc Natl Acad Sci U S A. 105:7964-7969(2008).