Mature sequence gma-miR1508a

Accession numberMIMAT0007366
IDgma-miR1508a
Previous IDsgma-miR1508
Stem-Loop gma-MIR1508a
Sequence
ucuagaaagggaaauagcaguug
Get sequence
Deep sequencing reads, experiments

References

1
PMID:18402695 "Novel and nodulation-regulated microRNAs in soybean roots" Subramanian S, Fu Y, Sunkar R, Barbazuk WB, Zhu JK, Yu O BMC Genomics. 9:160(2008).
2
PMID:19084500 "Identification and expression analysis of miRNAs from nitrogen-fixing soybean nodules" Wang Y, Li P, Cao X, Wang X, Zhang A, Li X Biochem Biophys Res Commun. 378:799-803(2009).
3
PMID:21504877 "MicroRNAs in the shoot apical meristem of soybean" Wong CE, Zhao YT, Wang XJ, Croft L, Wang ZH, Haerizadeh F, Mattick JS, Singh MB, Carroll BJ, Bhalla PL J Exp Bot. 62:2495-2506(2011).
4
PMID:22156213 "MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs" Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC Genes Dev. 25:2540-2553(2011).