Mature sequence gga-miR-1467-3p

Accession numberMIMAT0007346
IDgga-miR-1467-3p
Previous IDsgga-miR-1467*
Stem-Loop gga-mir-1467-1 gga-mir-1467-2
Sequence
ucacaccagaguaacugggauc
Get sequence
Deep sequencing198 reads, 4 experiments
Predicted targets

References

1
PMID:18430245 "Deep sequencing of chicken microRNAs" Burnside J, Ouyang M, Anderson A, Bernberg E, Lu C, Meyers BC, Green PJ, Markis M, Isaacs G, Huang E, Morgan RW BMC Genomics. 9:185(2008).
2
PMID:18469162 "A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach" Glazov EA, Cottee PA, Barris WC, Moore RJ, Dalrymple BP, Tizard ML Genome Res. 18:957-964(2008).