Mature sequence gga-miR-1434

Accession numberMIMAT0007295
IDgga-miR-1434
Stem-Loop gga-mir-1434
Sequence
gugcgugaugauggaaaauu
Get sequence
Deep sequencing99 reads, 5 experiments
Predicted targets

References

1
PMID:18463306 "Conservation of small RNA pathways in platypus" Murchison EP, Kheradpour P, Sachidanandam R, Smith C, Hodges E, Xuan Z, Kellis M, Grutzner F, Stark A, Hannon GJ Genome Res. 18:995-1004(2008).