Mature sequence oan-miR-1419d-3p

Accession numberMIMAT0007254
IDoan-miR-1419d-3p
Previous IDsoan-miR-1419d*
Stem-Loop oan-mir-1419d
Sequence
augucauccuccagcaccacg
Get sequence
Deep sequencing6 reads, 2 experiments

References

1
PMID:18463306 "Conservation of small RNA pathways in platypus" Murchison EP, Kheradpour P, Sachidanandam R, Smith C, Hodges E, Xuan Z, Kellis M, Grutzner F, Stark A, Hannon GJ Genome Res. 18:995-1004(2008).