Mature sequence oan-miR-1409-3p

Accession numberMIMAT0007227
IDoan-miR-1409-3p
Previous IDsoan-miR-1409*
Stem-Loop oan-mir-1409
Sequence
cagcgcacucaaguucucaugc
Get sequence
Deep sequencing593 reads, 3 experiments

References

1
PMID:18463306 "Conservation of small RNA pathways in platypus" Murchison EP, Kheradpour P, Sachidanandam R, Smith C, Hodges E, Xuan Z, Kellis M, Grutzner F, Stark A, Hannon GJ Genome Res. 18:995-1004(2008).