Mature sequence oan-miR-143-3p

Accession numberMIMAT0007144
IDoan-miR-143-3p
Previous IDsoan-miR-143
Stem-Loop oan-mir-143
Sequence
ugagaugaagcacuguagcuc
Get sequence
Deep sequencing2501875 reads, 5 experiments
Database links
QuickGO function

References

1
PMID:18463306 "Conservation of small RNA pathways in platypus" Murchison EP, Kheradpour P, Sachidanandam R, Smith C, Hodges E, Xuan Z, Kellis M, Grutzner F, Stark A, Hannon GJ Genome Res. 18:995-1004(2008).