Mature sequence oan-miR-1419a-5p

Accession numberMIMAT0007070
IDoan-miR-1419a-5p
Previous IDsoan-miR-1419a*
Stem-Loop oan-mir-1419a
Sequence
agugccgggagguggcaucagg
Get sequence
Deep sequencing14 reads, 1 experiments

References

1
PMID:18463306 "Conservation of small RNA pathways in platypus" Murchison EP, Kheradpour P, Sachidanandam R, Smith C, Hodges E, Xuan Z, Kellis M, Grutzner F, Stark A, Hannon GJ Genome Res. 18:995-1004(2008).