Mature sequence oan-miR-23a-3p

Accession numberMIMAT0007061
IDoan-miR-23a-3p
Previous IDsoan-miR-23a
Stem-Loop oan-mir-23a
Sequence
aucacauugccagggauuucca
Get sequence
Deep sequencing41436 reads, 5 experiments
Database links
QuickGO function

References

1
PMID:18463306 "Conservation of small RNA pathways in platypus" Murchison EP, Kheradpour P, Sachidanandam R, Smith C, Hodges E, Xuan Z, Kellis M, Grutzner F, Stark A, Hannon GJ Genome Res. 18:995-1004(2008).