Mature sequence oan-miR-23a-5p

Accession numberMIMAT0007060
IDoan-miR-23a-5p
Previous IDsoan-miR-23a*
Stem-Loop oan-mir-23a
Sequence
gggguuccuggugaugcgauuu
Get sequence
Deep sequencing61 reads, 3 experiments

References

1
PMID:18463306 "Conservation of small RNA pathways in platypus" Murchison EP, Kheradpour P, Sachidanandam R, Smith C, Hodges E, Xuan Z, Kellis M, Grutzner F, Stark A, Hannon GJ Genome Res. 18:995-1004(2008).