Mature sequence oan-miR-15b-3p

Accession numberMIMAT0007051
IDoan-miR-15b-3p
Previous IDsoan-miR-15b*
Stem-Loop oan-mir-15b
Sequence
cgaaucauuauuugcugcuuu
Get sequence
Deep sequencing20 reads, 4 experiments

References

1
PMID:18463306 "Conservation of small RNA pathways in platypus" Murchison EP, Kheradpour P, Sachidanandam R, Smith C, Hodges E, Xuan Z, Kellis M, Grutzner F, Stark A, Hannon GJ Genome Res. 18:995-1004(2008).