Mature sequence oan-miR-223-5p

Accession numberMIMAT0007019
IDoan-miR-223-5p
Previous IDsoan-miR-223*
Stem-Loop oan-mir-223
Sequence
cguguauuugacaagcugaguug
Get sequence
Deep sequencing40 reads, 5 experiments

References

1
PMID:18463306 "Conservation of small RNA pathways in platypus" Murchison EP, Kheradpour P, Sachidanandam R, Smith C, Hodges E, Xuan Z, Kellis M, Grutzner F, Stark A, Hannon GJ Genome Res. 18:995-1004(2008).