Mature sequence oan-miR-146b-3p

Accession numberMIMAT0007008
IDoan-miR-146b-3p
Previous IDsoan-miR-146b*
Stem-Loop oan-mir-146b
Sequence
gcccuagggauucaguuccaca
Get sequence
Deep sequencing49 reads, 4 experiments

References

1
PMID:18463306 "Conservation of small RNA pathways in platypus" Murchison EP, Kheradpour P, Sachidanandam R, Smith C, Hodges E, Xuan Z, Kellis M, Grutzner F, Stark A, Hannon GJ Genome Res. 18:995-1004(2008).