Mature sequence oan-miR-146b-5p

Accession numberMIMAT0007007
IDoan-miR-146b-5p
Previous IDsoan-miR-146b
Stem-Loop oan-mir-146b
Sequence
ugagaacugaauuccauaggcu
Get sequence
Deep sequencing303044 reads, 5 experiments
Database links
QuickGO function

References

1
PMID:18463306 "Conservation of small RNA pathways in platypus" Murchison EP, Kheradpour P, Sachidanandam R, Smith C, Hodges E, Xuan Z, Kellis M, Grutzner F, Stark A, Hannon GJ Genome Res. 18:995-1004(2008).