Mature sequence oan-miR-215-5p

Accession numberMIMAT0007000
IDoan-miR-215-5p
Previous IDsoan-miR-215
Stem-Loop oan-mir-215
Sequence
augaccuaugaauugacagac
Get sequence
Deep sequencing649025 reads, 5 experiments
Database links
QuickGO function

References

1
PMID:18463306 "Conservation of small RNA pathways in platypus" Murchison EP, Kheradpour P, Sachidanandam R, Smith C, Hodges E, Xuan Z, Kellis M, Grutzner F, Stark A, Hannon GJ Genome Res. 18:995-1004(2008).