Mature sequence oan-miR-206-3p

Accession numberMIMAT0006995
IDoan-miR-206-3p
Previous IDsoan-miR-206
Stem-Loop oan-mir-206
Sequence
uggaauguaaggaagugugugg
Get sequence
Deep sequencing308834 reads, 5 experiments

References

1
PMID:18463306 "Conservation of small RNA pathways in platypus" Murchison EP, Kheradpour P, Sachidanandam R, Smith C, Hodges E, Xuan Z, Kellis M, Grutzner F, Stark A, Hannon GJ Genome Res. 18:995-1004(2008).