Mature sequence oan-miR-206-5p

Accession numberMIMAT0006994
IDoan-miR-206-5p
Previous IDsoan-miR-206*
Stem-Loop oan-mir-206
Sequence
acaugcuucuuuauaucccca
Get sequence
Deep sequencing12 reads, 5 experiments

References

1
PMID:18463306 "Conservation of small RNA pathways in platypus" Murchison EP, Kheradpour P, Sachidanandam R, Smith C, Hodges E, Xuan Z, Kellis M, Grutzner F, Stark A, Hannon GJ Genome Res. 18:995-1004(2008).