Mature sequence oan-miR-26-1-3p

Accession numberMIMAT0006992
IDoan-miR-26-1-3p
Previous IDsoan-miR-26*
Stem-Loop oan-mir-26-1
Sequence
ccuguccucgguuacuugucuc
Get sequence
Deep sequencing439 reads, 5 experiments

References

1
PMID:18463306 "Conservation of small RNA pathways in platypus" Murchison EP, Kheradpour P, Sachidanandam R, Smith C, Hodges E, Xuan Z, Kellis M, Grutzner F, Stark A, Hannon GJ Genome Res. 18:995-1004(2008).