Mature sequence oan-miR-1420b-3p

Accession numberMIMAT0006925
IDoan-miR-1420b-3p
Previous IDsoan-miR-1420b
Stem-Loop oan-mir-1420b
Sequence
aaagugccaccugacuggauga
Get sequence
Deep sequencing25 reads, 2 experiments

References

1
PMID:18463306 "Conservation of small RNA pathways in platypus" Murchison EP, Kheradpour P, Sachidanandam R, Smith C, Hodges E, Xuan Z, Kellis M, Grutzner F, Stark A, Hannon GJ Genome Res. 18:995-1004(2008).