Mature sequence oan-miR-460-3p

Accession numberMIMAT0006916
IDoan-miR-460-3p
Previous IDsoan-miR-460*
Stem-Loop oan-mir-460
Sequence
cacagcgcguacaauguggau
Get sequence
Deep sequencing543 reads, 5 experiments

References

1
PMID:18463306 "Conservation of small RNA pathways in platypus" Murchison EP, Kheradpour P, Sachidanandam R, Smith C, Hodges E, Xuan Z, Kellis M, Grutzner F, Stark A, Hannon GJ Genome Res. 18:995-1004(2008).