Mature sequence oan-miR-219-3p

Accession numberMIMAT0006900
IDoan-miR-219-3p
Previous IDsoan-miR-219
Stem-Loop oan-mir-219
Sequence
agaauugugacuggacaucugu
Get sequence
Deep sequencing74821 reads, 4 experiments
Database links
QuickGO function

References

1
PMID:18463306 "Conservation of small RNA pathways in platypus" Murchison EP, Kheradpour P, Sachidanandam R, Smith C, Hodges E, Xuan Z, Kellis M, Grutzner F, Stark A, Hannon GJ Genome Res. 18:995-1004(2008).