Mature sequence oan-miR-181b-1-3p

Accession numberMIMAT0006836
IDoan-miR-181b-1-3p
Previous IDsoan-miR-181b*
Stem-Loop oan-mir-181b-1
Sequence
cucacugaacaaugaauggaa
Get sequence
Deep sequencing2400 reads, 5 experiments

References

1
PMID:18463306 "Conservation of small RNA pathways in platypus" Murchison EP, Kheradpour P, Sachidanandam R, Smith C, Hodges E, Xuan Z, Kellis M, Grutzner F, Stark A, Hannon GJ Genome Res. 18:995-1004(2008).