Mature sequence oan-miR-181b-5p

Accession numberMIMAT0006835
IDoan-miR-181b-5p
Previous IDsoan-miR-181b
Stem-Loop oan-mir-181b-1 oan-mir-181b-2
Sequence
aacauucauugcugucggugg
Get sequence
Deep sequencing677477 reads, 5 experiments
Database links
QuickGO function

References

1
PMID:18463306 "Conservation of small RNA pathways in platypus" Murchison EP, Kheradpour P, Sachidanandam R, Smith C, Hodges E, Xuan Z, Kellis M, Grutzner F, Stark A, Hannon GJ Genome Res. 18:995-1004(2008).
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).