Mature sequence cfa-miR-199

Accession numberMIMAT0006642
IDcfa-miR-199
Stem-Loop cfa-mir-199-1 cfa-mir-199-2 cfa-mir-199-3
Sequence
acaguagucugcacauugguu
Get sequence
Deep sequencing reads, experiments
Predicted targets

References

1
PMID:18392026 "Discovering microRNAs from deep sequencing data using miRDeep" Friedlander MR, Chen W, Adamidi C, Maaskola J, Einspanier R, Knespel S, Rajewsky N Nat Biotechnol. 26:407-415(2008).