Mature sequence cfa-miR-455

Accession numberMIMAT0006603
IDcfa-miR-455
Stem-Loop cfa-mir-455
Sequence
uaugugccuuuggacuacaucg
Get sequence
Deep sequencing reads, experiments
Predicted targets

References

1
PMID:18392026 "Discovering microRNAs from deep sequencing data using miRDeep" Friedlander MR, Chen W, Adamidi C, Maaskola J, Einspanier R, Knespel S, Rajewsky N Nat Biotechnol. 26:407-415(2008).