Mature sequence mml-miR-802

Accession numberMIMAT0006515
IDmml-miR-802
Stem-Loop mml-mir-802
Sequence
caguaacaaagauucauccuugu
Get sequence
Deep sequencing11 reads, 2 experiments
Predicted targets

References

1