Mature sequence mml-miR-663

Accession numberMIMAT0006502
IDmml-miR-663
Stem-Loop mml-mir-663-1 mml-mir-663-2 mml-mir-663-3 mml-mir-663-4 mml-mir-663-5 mml-mir-663-6 mml-mir-663-7 mml-mir-663-8 mml-mir-663-9 mml-mir-663-10 mml-mir-663-11
Sequence
aggcggggcgcugcgggaccgc
Get sequence
Deep sequencing77 reads, 4 experiments
Predicted targets

References

1