Mature sequence mml-miR-654-3p

Accession numberMIMAT0006496
IDmml-miR-654-3p
Stem-Loop mml-mir-654
Sequence
uaugucugcugaccaucaccuu
Get sequence
Deep sequencing4146 reads, 9 experiments
Database links
Predicted targets
QuickGO function

References

1