Mature sequence mml-miR-654-5p

Accession numberMIMAT0006495
IDmml-miR-654-5p
Stem-Loop mml-mir-654
Sequence
uggugggccgcagaacaugugc
Get sequence
Deep sequencing1464 reads, 9 experiments
Predicted targets

References

1