Mature sequence mml-miR-653-5p

Accession numberMIMAT0006494
IDmml-miR-653-5p
Stem-Loop mml-mir-653
Sequence
guguugaaacaaucucuacug
Get sequence
Deep sequencing3192 reads, 7 experiments

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).