Mature sequence mml-miR-652

Accession numberMIMAT0006493
IDmml-miR-652
Stem-Loop mml-mir-652
Sequence
aauggcgccacuaggguugug
Get sequence
Deep sequencing10767 reads, 9 experiments
Predicted targets

References

1