Mature sequence mml-miR-642

Accession numberMIMAT0006483
IDmml-miR-642
Stem-Loop mml-mir-642
Sequence
gucccucuccaaaugugucuug
Get sequence
Deep sequencing1 reads, 1 experiments
Predicted targets

References

1