Mature sequence mml-miR-556-5p

Accession numberMIMAT0006424
IDmml-miR-556-5p
Stem-Loop mml-mir-556
Sequence
gaugaacucauuguaauaugag
Get sequence
Deep sequencing reads, experiments
Predicted targets

References

1