Mature sequence mml-miR-552

Accession numberMIMAT0006421
IDmml-miR-552
Stem-Loop mml-mir-552
Sequence
aacgggugacugguuagacaa
Get sequence
Deep sequencing8 reads, 3 experiments
Predicted targets

References

1