Mature sequence mml-miR-525

Accession numberMIMAT0006402
IDmml-miR-525
Stem-Loop mml-mir-525
Sequence
cuccagagggaugcacuuucu
Get sequence
Deep sequencing67 reads, 3 experiments
Predicted targets

References

1