Mature sequence mml-miR-520a-3p

Accession numberMIMAT0006388
IDmml-miR-520a-3p
Stem-Loop mml-mir-520a
Sequence
aaagugcuucccuuuggacugu
Get sequence
Deep sequencing1306 reads, 4 experiments
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).