Mature sequence mml-miR-519d

Accession numberMIMAT0006387
IDmml-miR-519d
Stem-Loop mml-mir-519d
Sequence
caaagugcuuccuuuuagagug
Get sequence
Deep sequencing reads, experiments
Predicted targets

References

1