Mature sequence mml-miR-455-5p

Accession numberMIMAT0006339
IDmml-miR-455-5p
Stem-Loop mml-mir-455
Sequence
uaugugccuuuggacuacaucg
Get sequence
Deep sequencing10072 reads, 9 experiments
Database links
Predicted targets
QuickGO function

References

1