Mature sequence mml-miR-342-3p

Accession numberMIMAT0006283
IDmml-miR-342-3p
Stem-Loop mml-mir-342
Sequence
ucucacacagaaaucgcacccgu
Get sequence
Deep sequencing34272 reads, 9 experiments
Database links
Predicted targets
QuickGO function

References

1