Mature sequence mml-miR-302b

Accession numberMIMAT0006260
IDmml-miR-302b
Stem-Loop mml-mir-302b
Sequence
uaagugcuuccauguuuuaguag
Get sequence
Deep sequencing65 reads, 9 experiments
Predicted targets

References

1