Mature sequence mml-miR-219-3p

Accession numberMIMAT0006246
IDmml-miR-219-3p
Stem-Loop mml-mir-219-2
Sequence
agaauuguggcuggacaucugu
Get sequence
Deep sequencing250460 reads, 9 experiments
Database links
Predicted targets
QuickGO function

References

1